Clicky

Although the order of progression of M3FL replication was consistent among different mice after intranasal infection with 5 × 105 PFU of M3FL (Fig. but decreased in intensity over time. Red borders denote increased abundance during infection. Canonical subunits have preferential binding partners, p65 with c-Rel or p50, and p50 dimerizing with itself (Vallabhapurapu and Karin, 2009). Wild-type B6 mice were infected i.n. However, chronic γHV68 infection is also regulated by host genes, among which IFN-γ is of particular importance. (B) Reciprocal frequency of mLANA+ transitional B cells at 7, 16, 28, 42, and 90 days postinoculation calculated from flow cytometric analyses.

We thank R. The malignant cells had large nuclei with open chromatin and single prominent nucleoli (immunoblasts) or several small but conspicuous nucleoli (centroblasts). However, in the primary B cell assays, we found similar results as those observed with the Y→F mutations (data not shown). Mock-infected cells were exposed to 10 Gy of gamma radiation (γ-IR) as a positive control for p53 induction. 6A). It has been observed that CTL-mediated cytotoxicity induces varying types of DNA damage and exhibits different requirements for granzymes A and B, depending on the target cell used (47, 58). At 5 h p.i.

However, unlike the EBV Na protein, ORF49 itself failed to activate these promoters, suggesting that ORF49 participates in RTA-mediated transactivation on the lytic promoters, rather than directly activating the expressions of these genes. Mistrikova, J., Hricova, M., and Supolikova, M. Nevertheless, we observed that many MHV-68 ORFs were expressed to detectable levels by 24 hpi regardless of PAA treatment. We found that the p32 protein was principally located in the cytoplasmic regions of A20 and NIH 3T3 cells (Fig. Symbols represent individual mice, and lines represent the mean titer; the dashed line indicates the limit of detection (50 PFU/ml). v-Cyclin interaction with cellular CDKs is not required for viral replication in vitro but is required for acute replication in the lungs in vivo following low-dose intranasal inoculation.Although previous studies have shown no in vitro growth defect of v-cyclin-null viruses (25, 70), we sought to confirm this finding and extend it to the viruses harboring v-cyclin mutants that are unable to bind or activate cellular CDKs. Purified virions were exposed to various detergent concentrations, such as 2% NP-40 with HiNa, 2% Triton X-100 with 4% NP-40 (TxNP), or 1% NP-40 with 0.25% sodium deoxycholate (RIPA).

The peritoneum is the other major latency site that has been extensively characterized, where macrophages are the major cell type harboring latent virus (31). 2005. To the best of our knowledge, the downmodulation of latency by M1 is an unexpected and rare, if not unique, observation for a latency-associated herpesvirus gene. Samples were resolved by SDS-PAGE and subjected to immunoblot analyses. and J.J.O. Plaques appeared, and after complete CPE was reached, the supernatant was transferred to new BHK-21 cells and cultured in the presence of 25 μM xanthine and 100 μM mycophenolic acid to select recombinant viruses with an integrated BAC plasmid containing the gpt marker (14). Cells were fractionated into B-cell and non-B-cell populations by staining with a PE-conjugated antibody to the pan-B-cell marker CD19.

W., Plaisance, K. Cells were then washed twice with PBS-1% FCS and resuspended at 1 × 108 cells/ml. VSV-G-pseudotyped transducing retroviruses were generated by cotransfection of HEK293T cells with pVSV-G, which expresses VSV-G; pHIT60, which expresses MLV viral proteins; and the retroviral vectors, as described previously (5). Primer for amplification of env: 5’ CACCCTCTGTGGACCTGGTG; 3’ TAGCTTGAGTCTGTTCCAGGC. Additionally, two important controls were used: MHV68-YFP, in which the YFP transgene under the control of the HCMV IE promoter was cloned into a neutral locus in the viral genome (efficiently marking MHV68 infected B cells and plasma cells) [23]; and (ii) MHV68-M1st.YFP, which contains the M1 translational stop mutation (M1-null virus) in the context of the YFP transgene cloned into the neutral locus (Figure 1B). On the basis of the genomic sequence of γHV68, the virus is closely related to both EBV and KSHV (57). In addition, some of these studies suggest that PML NBs may play a role in establishment or maintenance of latency.

Mice were infected intranasally at 6 to 8 weeks of age with 2 × 104 PFU of virus in a volume of 30 μl, in accordance with Home Office Project License 80/1579. Some viruses can even co-opt core mRNA degradation components for their own purposes, as flaviviruses do to generate noncoding subgenomic viral RNAs [14]. There is evidence (3) of MHV-68 infection in splenic germinal centers, and both the non-antigen-specific B-cell activation and the CD4-dependent increase in viral load may reflect an exploitation by the virus of normal germinal-center function. We provide the first evidence that STAT3 expression is needed for murine gammaherpesvirus 68 to establish latency in primary B cells during an active immune response to infection.