Clicky

The reaction was stopped on ice with 20 mM EDTA (pH 8.0) Tris HCl (pH 8.0) and NaCl were then added to give final concentrations of 20 and 250 mM, respectively, and a protease inhibitor cocktail (PILL; Roche Molecular Biochemicals) was added. Besides angiogenesis, KSHV miRNAs are also involved in cell motility. The homology between the proteins encoded by BGHV8 and those encoded by KSHV is not very high, and yet it is likely that certain functions are conserved between these proteins, as has been shown previously for KSHV and other herpesviruses (23, 24). All experimental manipulations of mice were approved by the Institutional Animal Care and Use Committee of the Medical College of Wisconsin. Virol. Quantitative real-time RT-PCR analysis.To determine the relative level of viral gene transcription, total RNA was extracted from peritoneal cells using TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. A20-HE1 and A20-HE2 (16) and A20 were maintained in RPMI medium supplemented with 100 U penicillin/ml, 100 mg streptomycin/ml, 10% FCS, and 2 mM l-glutamate; the A20-HE cells were also maintained with 20 ng/ml hygromycin and 300 μg/ml B sulfate in the medium.

Cell culture.Telomerase-immortalized RhFs were grown in complete medium (Dulbecco’s modified Eagle’s medium [Gibco] supplemented with 1 nM puromycin, 1 mM sodium pyruvate, and 10% fetal bovine serum [Gibco]), as described previously (26). Briefly, 14 μg of total RNA was electrophoresed through a 15% acrylamide urea denaturing gel and electroblot transferred to Zeta-Probe GT membranes (Bio-Rad). However, the interactions between latent viruses and IFNαβ are largely unexplored. Assays for latency.On the indicated day postinfection, the frequency of virus genome-positive cells and the capacity of these cells to reactivate lytic γHV68 replication were determined as previously described (89, 91). Cells.NIH 3T3, NIH 3T12, BHK-21, Vero, and 293T cells were cultured at 37°C with 5% CO2 in complete Dulbecco’s modified Eagle medium containing 10% fetal bovine serum and supplemented with penicillin and streptomycin. Presumably, this switch in tropism favors the movement between epithelial cells and B cells during the cycle of persistence [19]. 1).

Whether similar interactions are shared with other G2HVs such as MHV68 and whether they regulate lytic viral replication are not known. In addition, MuHV-4 persists in laboratory mice without causing disease unless there is immune suppression, and is transmitted through sexual contact (François et al., 2013). STAT3 is a well-studied member of the signal transducer and activator of transcription (STAT) family. Here we show that in agreement with previous studies in cells during lytic KSHV infection [4], [10], [11], there is a dramatic reduction in the levels of most cellular mRNAs in cells expressing SOX and muSOX, with a small percentage of genes induced. Cell viability was assayed via [3-(4,5-dimethylthiazol-2-yl) -2,5-diphenyltetrazolium bromide] MTT assays as previously described (Cho et al., 2008). KSHV Bcl-2 blocks apoptosis stimulated by overexpression of Bax or v-cyclin or by Sindbis virus infection (11, 12); however, in cellular assays, it does not appear to heterodimerize with pro-apoptotic Bcl-2 family members, such as Bax and Bak (13). The synthesized cDNAs were subjected to RT-qPCR or RT-PCR analysis with viral transcript-specific primers including RTA, ORF57, ORF29, and ORF73 or cellular β-actin-specific primers as described previously (Noh et al., 2012).

Both MHV68 orf36 and a related EBV-encoded kinase, BGLF4, interacted with HDAC1 and -2. This response is not limited to C57BL/6 mice, but occurs to varying degrees in a wide variety of inbred mice, demonstrating preferential expansion among strains expressing the H2b MHC haplotype (32, 39). First, we ligated the complementary oligonucleotides 5′GAGTGGCAGACCCTCTAGCTAGGATCCGAATTC and 5′GAATTCGGATCCTAGCTAGAGGGTCTGCCACTC into a blunted NcoI site (genomic coordinate 23503) in a HinDIII-I genomic clone (7). Analysis of the mechanisms responsible for gammaherpesvirus-associated lymphomagenesis in vivo has been hampered by the exquisite species specificity of human gammaherpesviruses and the expense and availability of primates. SOX is likely recruited to translating mRNAs, as it cosediments with translation initiation complexes and depletes polysomes. The nuclear factor kappa B (NF-κB) signaling pathway is well-known for its role in the promotion of inflammation and many aspects of B cell biology. In the second model, Lewis rats were exposed to UV-inactivated gammaHV-68 or to gammaHV-68, followed by passive transfer of encephalitogenic T lymphocytes specific for myelin basic protein.

Here, we report that the immediately early gene product of γHV68, replication transactivator (RTA), functions as a ubiquitin E3 ligase to promote RelA degradation and abrogate cytokine production. After intranasal inoculation, MHV-68 replicates lytically in the respiratory tract. In this study, we have investigated the cis element that mediates late gene expression during de novo lytic infection with murine gammaherpesvirus 68 (MHV-68). Infection has been associated with splenomegaly and pneumonitis and with a fatal arteritis in mice lacking responsiveness to gamma interferon (36, 38, 41, 42). Histopathology revealed vacuolar degeneration in the hepatocytes and leukocytosis in the sinusoidal lumina. Using this approach, M4, K3, ORF38, ORF50, ORF57 and ORF73 were designated as immediate-early genes based on cycloheximide treatment.